A sequence ladder is a list of all partial sequences of a biomolecule sequence. Sequence ladders can be produced which contain one or either of the termini, or represent all possible truncated sequences of the primary sequence. For example, a 5' sequence ladder for a 20-mer oligonucleotide with the sequence TAATACGACTCACTATAGGG would look something like this:
Position Mass Sequence
T1-G20 6125.1
TAATACGACTCACTATAGGG
A2-G20 5820.9
AATACGACTCACTATAGGG
A3-G20 5507.7
ATACGACTCACTATAGGG
T4-G20 5194.5
TACGACTCACTATAGGG
A5-G20 4890.3
ACGACTCACTATAGGG
C6-G20 4577.0
CGACTCACTATAGGG
G7-G20 4287.9
GACTCACTATAGGG
A8-G20 3958.7
ACTCACTATAGGG
C9-G20 3645.4 CTCACTATAGGG
T10-G20
3356.3 TCACTATAGGG
C11-G20 3052.1
CACTATAGGG
A12-G20 2762.9 ACTATAGGG
C13-G20 2449.7
CTATAGGG
T14-G20 2160.5 TATAGGG
A15-G20 1856.3
ATAGGG
T16-G20 1543.1 TAGGG
A17-G20 1238.9
AGGG
G18-G20 925.7 GGG
G19-G20 596.5
GG
G20-G20 267.2 G
Conversely, a 3' oligo sequence ladder would contain the 5' end and would produce a list of sequences with successive removal of nucleotides from the 3' end.
ProMass can calculate sequence ladders for either proteins or oligonucleotides and indicate experimental masses which matched these calculated masses in the deconvoluted data. This feature is particularly useful for identifying failure sequences in LC/MS data of synthetic oligonucleotides. The feature can also be used to confirm masses resulting from exonuclease digestion or metabolism of oligonucleotides. For proteins, the feature can be used to look for components resulting from either N- or C-terminal enzymatic processing. A sequence ladder summary can also be used to look for all possible internal fragments from a given biomolecule sequence. Note that the number of possible masses produced from an internal sequence ladder increases rapidly with the length of the sequence. It is often possible to identify multiple subsequences that have the same or nearly the same molecular mass.
In order for ProMass to produce a sequence ladder summary you need to do the following:
sequence = oligo
or
sequence = protein
If you want a 5' (oligonucleotide) or N-terminal (protein) sequence ladder summary enter one of the following in the Target Info field to indicate removal of residues from the left terminus:
ladder = left
or
ladder = 5'
If you want a 3' (oligonucleotide) or C-terminal (protein) sequence ladder enter the following in the Target Info field to indicate removal of residues from the right terminus:
ladder = right
or
ladder = 3'
If you want to look for masses that contain either termini, enter the following in the Target Info field:
ladder = both
If you want to look for masses considering all possible subsequences of the primary sequence, enter the following in the Target Info field:
ladder = internal
For oligo sequences, ProMass will also consider the possibility of a cleavage that leaves a terminal phosphate on the terminus where cleavage has occurred. If you want to turn this feature off for the data file that you are processing, then enter:
termini = no phos
in the Target Info field. For oligonucleotides, you can also allow for the searching of cyclic phosphates at the 3' terminus. This is enabled by the command termini = cyclic phos in the Target Info field. A cyclic phosphate would only be considered if a cleavage occurred at the 3' end and thus would not be considered for a 5' ladder.
When more than one sequence is entered in the BioSequence field (separated by a comma), ProMass will search for the appropriate ladders from each individual sequence.
The screenshot below shows an Xcalibur sample list properly configured to produce a 5' sequence ladder summary.
The sequence ladder summary appears in the chromatogram-level report after the target mass summary section. An example is shown below for the data file processed in the Xcalibur sample list shown above. In the example below, the 5' sequence ladder summary is used to identify oligonucleotide sequence failures from the synthesis of an 80-mer oligonucleotide.
